#!/usr/bin/perl 

use CGI qw(:standard);
use Net::SMTP;
use vars qw();

my $smtp_host = "stat.wharton.upenn.edu";
my $sender_address = "stjensen\@wharton.upenn.edu"; 

$action="BioOptimizer.web.cgi";

#####################Main Program#####################

BOinputform();

$seqfile = param('seqs');
$biopfile = param('biop');
$nummotif = param('nummotif');
$numblock = param('numblock');
$w1 = param('w1');
$w2 = param('w2');
$mingap = param('mingap');
$maxgap = param('maxgap');
$revcomp = param('revcomp');
$rc = 0;
if ($revcomp eq "Both Strands"){
  $rc = 1;
}
$email = param('email');
$jobname = param('jobname');

unless(open (OUT,">programfiles/$jobname.par")){
    print "Unable to open file $jobname.par: $!";
    exit(); 
}

print OUT "nummotif=$nummotif\nnumblock=$numblock\n";
print OUT "w1=$w1\nw2=$w2\nmingap=$mingap\nmaxgap=$maxgap\nrevcomp=$revcomp\trc = $rc\n";
print OUT "email=$email\njobname=$jobname\n";
close(OUT);

unless(open(OUT,">programfiles/$jobname.seq")){
    print "Unable to open file $jobname.seq: $!"; 
    exit();
}
print OUT "$seqfile";
close(OUT);

unless(open(OUT,">programfiles/$jobname.biop")){
    print "Unable to open file $jobname.biop: $!";
    exit();
}
print OUT "$biopfile";
close(OUT);


if(!defined(my $kidpid = fork())){ # if the fork fails (OS doesn't support it, not enough memory) warn the user
    print "Cannot fork: $! -- Your job has not been executed. <br />\n";                 
}
elsif ($kidpid == 0){ # this only runs in the child process generated by the fork
    
    my $content = ""; 
    
    if ($numblock eq "One-Block"){
        $content .= `./BioOptimizer.biop.web programfiles/$jobname.seq programfiles/$jobname.biop $nummotif $rc $w1` ; 
    }
    
    if ($numblock eq "Two-Block"){
        $content .= `./BioOptimizer.twoblock.web programfiles/$jobname.seq programfiles/$jobname.biop $nummotif $rc $w1 $w2 $mingap $maxgap`; 
    }

    # mail the job info
    mail_results( $email , $jobname , $content ); 

    # send the child away
    exit(); 

}
else { # this only runs in the parent process of the fork
    # nothing to do here in your case, the code continues on afterwards
}





####################Subroutines#############################

sub BOinputform {
  print header;
  print start_html ("BioOptimizer Web Server"), start_multipart_form(-action=>"$action",-method=>'post');
  print "<center><h1>Welcome to the BioOptimizer Web Server</h1></center>";
  print "<hr><h3>About BioOptimizer</h3>";
  print "BioOptimizer is an algorithm designed to clean up
  the motifs found by BioProspector by finding the configuration of motif start
  sites that maximizes a scoring function based on the log-posterior
  distribution given in <i>Jensen et al (2004) </i> and <i>Jensen and Liu (2004)</i>.
  In addition, the algorithm allows the motif width to vary and
  attempts to find the best motif width, again in terms of maximizing
  the scoring function.<p> <a href=\"BioOptimizer.tgz\">Click here 
  to download a tar file with stand-alone perl scripts of BioOptimizer</a>.<p>";
  print "<b>Jensen, S.T. and Liu, J.S. (2004). <br>BioOptimizer: a
  Bayesian scoring function approach to motif discovery. <br> <i>Bioinformatics</i> 20:1557-1564.</b><p>"; 
  print "<b>Jensen, S.T., Liu, X.S., Zhou, Q. and Liu,
  J.S. (2004). <br> Computational discovery of gene regulatory binding
  motifs: a Bayesian perspective. <br> <i>Statistical Science</i> 19:188-204.</b><p>";
  print "Please reference the first of these papers when using results from BioOptimizer.<p>";
  print "<hr><h3>Step 1: Finding Motifs with BioProspector</h3>";
  print "You can use the program <i>BioProspector</i> to find one or
  two-block motifs of known width in your sequence dataset either by downloading a stand-alone
  version or using a web-based version of BioProspector, both of which are found at
  the <a href=\"http://robotics.stanford.edu/~xsliu/BioProspector/\">BioProspector
  website</a> (under \"Motif-Finding\").<p>";
  print "For both BioProspector and BioOptimizer, your sequences must be in FASTA format e.g.,<p>";
  print "\>genename1<br>acgtacgatcgatcatgactacgatcgactgcat<br>\>genename2<br>agctagctagctgactagctagctacgtacgatc  <p>";
  print "<hr><h3>Step 2: Inputting Original Sequences</h3>";
  print "BioOptimizer needs your original sequences, which you should cut and paste into the box below:<p>";
  print "<textarea name='seqs' rows=5 cols=80></textarea><p>";
  print "<hr><h3>Step 3: Inputting Motif Output from BioProspector</h3>";
  print "BioOptimizer also needs your BioProspector output, which can contain one or more discovered motifs found in same set of sequences.  You can just cut and paste the entire BioProspector output file into the box below:<p>";
  print "<textarea name='biop' rows=5 cols=80></textarea><p>";
  print "<hr><h3>Step 4: Providing Motif Parameters</h3>";
  print "<ol>";
  print "<li>Please give the number of motifs contained in your BioProspector output:  ";
  print "<input type='text' name='nummotif' size = 2><p>";
  print "<li>Are the BioProspector results for a one-block or two-block motif?  ";
  print "<select name = 'numblock' size = 1><option selected>One-Block<option>Two-Block</select><p>";
  print "<li>BioProspector forced you to input a fixed motif width, but BioOptimizer will let the motif width vary in order to find an optimal width. However, you still must give an expected motif width for each block:<br>";
  print "Block 1 Expected Width: <input type='text' name='w1' size = 2><br>";
  print "Block 2 Expected Width: <input type='text' name='w2' size = 2> (leave blank for one-block motifs)<p>";
  print "<li>For a two-block motif, BioOptimizer will also try to find the optimal gap between the two blocks, but you must provide the maximum and minimum gap that you used for BioProspector<br>";
  print "Minimum Gap Length: <input type='text' name='mingap' size = 2> (leave blank for one-block motifs)<br>";
  print "Maximum Gap Length: <input type='text' name='maxgap' size = 2> (leave blank for one-block motifs)<p>";
  print "<li>Should the motif sites only be on the forward strand, or should both strands be searched? ";
  print "<select name = 'revcomp' size = 1><option selected>Forward Strand Only<option>Both Strands</select><p>";
  print "</ol>";
  print "<hr><h3>Step 5: Providing Email Address and Submitting Job</h3>";
  print "Your BioOptimizer results will be sent to the email address you provide.  You are also required to give a <b>job name</b> that will be used to identify your job on our server.  Once you have provided 
this information, press the submit button (only once!) to submit your job.<p>";
  print "Email Address: <input type='text' name='email' size = 50><p>";
  print "Job Name: <input type='text' name='jobname' size = 50> (no spaces please!)<p>";
  print "<input type = 'submit' value = 'Submit Job'>";
  print "<br><br><b>Note that the program may take some time (5-10 minutes) to run.  Please to do not refresh the browser or hit submit more than once!</b>";  
  print "<hr><h3>Additional Notes</h3>";
  print "<p>1: The \"Final BioOptimizer Score\" can be used to compare motifs from the same dataset.  The motif with the highest (least negative) BioOptimizer score is the best motif.<p>";
  print "2: In some cases, BioOptimizer will produce a motif with no sites, even when the input motif has sites. This means that the input motif has a lower score than a motif with no sites, which is an indication that the input motif is quite weak.<p>";
  end_form,
  end_html;
}

sub mail_results { 

    my $recipient   = shift ;                       # shift just pulls the first 
    my $jobname     = shift ;                       # item from the argument list
    my $content     = shift ;        
    my $subject     = "BioOptimizer Output: $jobname"; 
 
    my $smtp = Net::SMTP->new($smtp_host);          # smtp host

    $smtp->mail($sender_address);                   # mail from
    $smtp->to($recipient);                          # mail to

    $smtp->data();                                  # begin building the message
    $smtp->datasend("From: ${sender_address}\n");
    $smtp->datasend("To: ${recipient}\n");
    $smtp->datasend("Subject: $subject\n");
    $smtp->datasend("\n");
    $smtp->datasend($content);
    $smtp->dataend();                        

    $smtp->quit;                            # send and terminate

}